1. Describe which happens in the following mutations: addition, deletion, substitution, inversion, duplication and translocation.
Answer
addition = additional base-pair(s) are added
deletion = base-pair(s) are removed
substitution = base-pair(s) are added that replace others
inversion = base-pair(s) break off and reinsert in the same place but orientated differently
duplication = base-pairs are copied and remain in place alongside the original base-pairs
translocation = a few base-pairs break off and reinsert elsewhere in the DNA sequence
2. What is meant by a frame-shift mutation ? What types of mutations may cause this ?
Answer
It is when all the triplet codes downstream of the mutation change as a result. Addition or deletion mutation causes this.
3. Tay-Sachs disease is an inherited disease caused by a mutation in the HEXA gene in exon 11. This gene is responsible for coding for part of an enzyme called hexosaminidase A. This enzyme is responsible for breaking down of harmful substances present in lysosomes within nerve cells.
People who do not suffer from this disease have the base sequence: …TACGTCCACTGGAGTCAC…
People with Tay-Sachs disease have the base sequence: …TACGTCCACTGTATGGAGTCAC…
Explain what type of mutation causes Tay-Sachs.
Answer
Addition mutation causing a frameshift.
4. This specific mutation has a far greater detrimental effect than if only one base was involved. Explain why.
Answer
Insertion of four bases means that all downstream codons are altered, resulting in a very different primary structure of the protein or enzyme. This, in turn, changes the tertiary structure and the shape of the active site. As a result, the enzyme is no longer complementary to its substrates or harmful substances in lysosomes, so it cannot hydrolyze them, or it produces a non-functional enzyme.
5. Explain the significance of the mutation being in an exon.
Answer
Exons are coding parts of the gene. They remain in the sequence after splicing contributing to the amino acid sequence.
6. The table below shows the occurrence of the mutated allele within some different populations. Using your understanding of inheritance, explain the relationship between heterozygotes and affected homozygotes. Use suitable calculations in your answer.
Answer
Heterozygotes do not have the condition but are carriers and can pass the condition on to their children. The more heterozygotes in a population, the greater the chance of two parents having child who is homozygous for this allele. Ashkenazi Jews have 3.7% chance of carrying allele, so a 0.034% chance of having child with condition. The European and American population has a 0.3% chance of carrying allele, so a 0.00028% chance of having child with disease.
7. The occurrence of affected homozygotes calculated in the table above assumes there has been no artificial selection, and that both parents arise from the same ethnic group. Suggest what is meant by "no artificial selection" in this context.
Answer
It means that couples or embryos are screened for the allele.
8. Suggest why the assumption that both parents arise from same ethnic group is important.
Answer
Different populations have different frequencies of alleles.